FOX59
Cancer research and precision oncology
Contributor
Dr. Bharat Kwatra
Comp. Precision Oncology
Cancer genomics Artificial intelligence Computational biology Precision medicine
Cancer is not one disease. Every tumour carries its own biology.
I read the molecular, clinical and evidentiary picture of a complex cancer case together, and return a structured account of what it supports — and where it does not.
Dr. Bharat Kwatra · KPCIRC, New Delhi
What a molecular tumour board actually reads
Hover a cell to read the call
Missense
Truncating
Amplification
Deep deletion
Fusion
Splice
No alteration
Illustrative oncoprint — recurrent genes against alteration class, in the format a molecular tumour board reads. Shown to describe the method, not a patient cohort.
100+
Precision oncology cases
Complex cases taken through structured molecular and clinical review.
840+
Molecular profiles analysed
Somatic, germline and multi-omic profiles interpreted in clinical context.
90+
Tumour boards
Multidisciplinary molecular tumour board participation.
14+
Cancer types in personal case series
Distinct malignancies taken through personal precision oncology review.
18+
Countries reached
Research collaboration, case review and scientific engagement across eighteen or more countries.
Audiences
How can I help?
A patient holding a genomic report, an oncologist weighing a difficult case, and a company designing a biomarker programme are asking different questions. Each route below is written for the person actually asking.
For patients
Understand your cancer
Understand your cancer. Understand the evidence. Prepare for the next decision.
Explore precision oncology
For clinicians
Specialist molecular support
Specialist molecular and computational support for complex cancer cases.
Refer a case
For industry & research
Build, validate, translate
Build, validate and translate the next generation of oncology.
Discuss a collaboration
Precision oncology
When standard answers are not enough
Most cancer care follows well-established pathways, and for most patients that is exactly right. A precision oncology review is for the situations where the standard pathway has run out, or where the picture is more complicated than a protocol accounts for.
Rare or unusual cancers
Small evidence bases and fragmented expertise make the literature harder to apply.
Relapsed or progressive disease
The biology at relapse is often not the biology at diagnosis.
Treatment resistance
Resistance mechanisms may be visible molecularly before they are visible clinically.
Complex genomic findings
Long variant lists in which relevance, not detection, is the difficulty.
Multiple treatment options
Several defensible paths, and a need to compare them on their evidence.
Uncertain biomarker relevance
A marker reported, but its weight in this disease and this context unclear.
Clinical trial questions
Whether a relevant trial exists, and whether eligibility is plausible.
Hereditary cancer concerns
Family history or germline findings with implications beyond the patient.
Cancer of unknown primary
Where tissue of origin is unresolved and biology carries more of the weight.
Complex second opinions
A structured re-reading of the clinical, pathological and molecular record.
If one of these describes your situation, a review is unlikely to produce a treatment nobody has thought of. What it more often produces is a clearer account of what the record actually shows, which questions remain open, and what would answer them.
Not every finding carries the same weight
- I Therapeutic, in this disease Randomised or regulatory-grade evidence for this alteration in this cancer.
- II Therapeutic, another disease Strong evidence, but established in a different tumour type.
- III Clinical trial eligible Supports enrolment rather than a licensed treatment decision.
- IV Preclinical or case report Biologically plausible; the clinical evidence is thin or absent.
A molecular report lists findings. Tiering says which of them a decision can actually rest on — and the bar length is the strength of that support.
What happens
From first message to a clearer picture
Getting in touch does not commit you to anything. The first step is simply a conversation about whether a review would actually help in your situation — and if it would not, you will be told so plainly.
-
Get in touch
Call, message on WhatsApp, or send a short enquiry describing the situation and the question you most want answered.
-
A conversation
We establish what the question really is and which documents are needed. Nothing is charged for this.
-
Scope agreed in writing
What will be reviewed, how long it will take and any fee are confirmed before work begins.
-
Your records are reviewed
Clinical history, pathology, imaging and molecular results read together as one record rather than separately.
-
We talk it through
The findings are explained in language you can follow, with time for your questions and your family’s.
-
Your treating team gets it too
The written analysis goes to your oncologist in a form they can act on — so it strengthens that relationship rather than competing with it.
Cancer types
Find your cancer
Sixty-eight disease pages, written in plain language: what the molecular picture usually involves, which tests are worth asking about, and the questions worth putting to your treating team.
Breast Cancer
Breast cancer is not a single disease. Receptor status and molecular subty…
Colorectal Cancer
Colorectal cancer has one of the better-characterised molecular landscapes…
Lung Cancer
Lung cancer is where molecular profiling most visibly changed clinical pra…
Head & Neck Cancer
Head and neck cancer covers several anatomical subsites whose biology diff…
Ovarian Cancer
Ovarian cancer is among the clearest examples of germline and somatic test…
Prostate Cancer
Prostate cancer spans an unusually wide clinical range, from indolent dise…
Leukaemia
Leukaemia classification is molecular in a way few solid tumours are. Cyto…
Lymphoma
Lymphoma comprises many distinct diseases sharing a lymphoid origin. Accur…
Why this work matters
From cancer data to cancer intelligence
Modern oncology generates enormous amounts of information — pathology, imaging, genomics, biomarkers, treatment history, response data and an expanding scientific literature.
The challenge is no longer simply obtaining more information.
The challenge is integrating it.
Precision oncology aims to connect molecular biology with clinical context, evidence and disease evolution so that the information becomes useful at the point of decision.
From cancer data to a clinical decision
- 01 Clinical context Who the patient is and what the disease has done
- 02 Pathology Tissue diagnosis, grade, immunohistochemistry
- 03 Molecular data Somatic, germline, circulating
- 04 Computation Annotation, tiering, modelling
- 05 Evidence What the literature actually supports
- 06 Decision Where it changes something — or does not
Each stage constrains the next. A molecular finding read before the clinical context is established is routinely over-weighted.
One base changes, and the biology changes with it
Reference DNA
ATGGAGGATCTGGTGGGAGCCGGT
Reference protein
MetGluAspLeuValGlyAlaGly
Variant DNA
ATGGAGGATCTGGAGGGAGCCGGT
Variant protein
MetGluAspLeuGluGlyAlaGly
A single substitution alters one amino acid. Whether that matters clinically depends on where it sits, what the protein does, and what the evidence says — which is the whole of the interpretive problem.
The work
Four pillars
These are not four separate practices. They are four views of the same problem — how molecular information becomes a better decision — and most real cases draw on all of them at once.
01
Precision Oncology
Molecular and clinical evidence brought together around complex cancer decisions.
02
Cancer Genomics
Next-generation sequencing, somatic and germline genomics, transcriptomics, multi-omics, single-cell biology, circulating tumour DNA, biomarkers and tumour evolution.
03
AI & Clinical Intelligence
Machine learning, natural language processing, molecular interpretation, clinical decision support and patient–trial matching.
04
Translational Research
Turning computational and molecular discoveries into clinically meaningful research programmes.
Scientific portfolio
Lines of enquiry
Thirteen active research themes, each stated as a question rather than a topic. The question determines the methods, and the methods determine what the work can honestly conclude.
Cancer Genomics
Which molecular alterations in a given tumour actually carry weight for a clinical decision, and how confide…
Active
Tumour Evolution
How does the molecular composition of a tumour change under selection pressure from treatment, and what does…
Active
ctDNA & Liquid Biopsy
When does circulating tumour DNA add information that changes a decision, and when is it simply another numb…
Active
Single-Cell Biology
What does cell-level resolution reveal about tumour heterogeneity and the microenvironment that bulk profili…
Active
Multi-Omics
How should genomic, transcriptomic, epigenomic and proteomic layers be combined so that the integration adds…
Active
Biomarker Discovery
Which candidate markers survive the move from a discovery cohort to an independent one, and under what analy…
Active
AI in Oncology
Where can machine learning materially assist oncology decision-making, and where does it mainly add unaccoun…
Active
Clinical NLP
How can unstructured clinical and scientific text be turned into structured, checkable information without l…
Active
Clinical Trial Matching
How can genuinely relevant trials be identified for a specific molecular and clinical profile, rather than m…
Active
Computational Oncology
What analytical infrastructure does an oncology service need for molecular interpretation to be reproducible…
Active
Pharmacogenomics
How do germline variants affecting drug metabolism alter the risk profile of systemic anti-cancer therapy fo…
In development
Clinical Decision Support
What form should molecular decision support take so that it supports clinical reasoning instead of substitut…
In development
Rare Cancer Biology
How should evidence be assembled and weighed for diseases where large randomised trials do not and may never…
Active
Credentials
Professional standing
Doctoral and postgraduate qualifications alongside fellowship and membership of professional scientific bodies. Earned and honorary doctorates are listed separately rather than run together. Awarding institutions are set out on the education page.
Doctorates
PhD
Doctor of Philosophy
PhD (hon)
Honorary doctorates
Postgraduate
MSc
Master of Science
Undergraduate & diplomas
Found. Dip.
Foundational Diploma in Medicine
UG Dip.
Undergraduate diploma
BSc
Bachelor of Science
Professional bodies
FRSM
Fellow of the Royal Society of Medicine
MRSB
Member of the Royal Society of Biology
MiSCB
Member, International Society for Computational Biology
aBGCI
Associate, Board of Genetic Counseling India
17
International awards
Awards and recognitions received at international scientific meetings and from international bodies.
57+
Publications
Peer-reviewed articles, preprints and review work across oncology, computational biology and translational research.
47+
Intellectual properties
Granted patents and filed applications across therapeutics, medical devices, biotechnology and engineering.
5+
Books
Long-form scientific writing across statistics, analytical methods and biomedical protocols.
Media & speaking
Public engagement
Cancer genomics is difficult to explain without either oversimplifying it or burying the point. These are attempts at neither — for broadcast, academic and general audiences.
CBS42
Cancer research and precision oncology
Contributor
Manav Rachna University
Cancer genomics and computational biology
Speaker
DASL Podcast
Precision oncology, genomics and artificial intelligence
Guest
Insights
Writing
Essays on the parts of precision oncology that are genuinely difficult — where the evidence is thin, where the reasoning carries the weight, and where enthusiasm has outrun the data.
Precision Oncology
A Cancer Diagnosis Is Not a Treatment Plan
A diagnosis names a disease. A treatment plan answers a different set of questions, and the distance between the two is where most of the difficult work of oncology happens.
7 MIN READ
Cancer GenomicsGenomic Data Is Not the Destination
Sequencing a tumour is now straightforward. Knowing what the result means for this patient, in this clinical situation, is the part that has not become easy.
8 MIN READ
Cancer GenomicsWhy More Mutations Do Not Necessarily Mean Better Decisions
Broader panels detect more alterations. Beyond a point, additional findings add interpretive burden faster than they add decision-relevant information.
6 MIN READ
The institute
Kwatra Precision Cancer Institute & Research Centre
KPCIRC is where the clinical side of this work lives — diagnostics, molecular tumour boards, computational capability and research operating as one service rather than as referrals between departments. It is also where consultations take place.
Where we meet
Kwatra Precision Cancer Institute & Research Centre
A-8, Shubham Enclave
Paschim Vihar, New Delhi
India
A-8, Shubham Enclave
Paschim Vihar, New Delhi
India
- Consulting hours
- Monday to Saturday
12:00 – 18:00 - Appointments
- 011 4353 3607
- +91 85951 44181
Messages only
By appointment only. Remote review is available for patients and clinicians elsewhere.
Photo 04
16:9
KPCIRC building exterior with signage
Architectural framing, straight-on or slight three-quarter. Late-afternoon light. Signage legible.
kpcirc-exterior.jpg
Precision Cancer Care
Clinical care organised around the molecular and clinical particulars of the individual case.
Molecular Diagnostics
Diagnostic capability spanning pathology, immunohistochemistry and molecular testing.
Molecular Tumour Board
Structured multidisciplinary review with molecular findings at the centre of the discussion.
Clinical Research
Clinical studies and trial participation as part of routine institutional activity.
Contact
Three routes, depending on who you are
Patients and families, referring clinicians, and industry or research partners each need a different conversation. Enquiries are routed accordingly rather than through a single generic form.